Skip to main navigation Skip to search Skip to main content

The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA

  • Michael E. Grossmann
  • , Donald J. Tindall

Research output: Contribution to journalArticlepeer-review

Abstract

The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCCCCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'- untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

Original languageEnglish (US)
Pages (from-to)10968-10975
Number of pages8
JournalJournal of Biological Chemistry
Volume270
Issue number18
DOIs
StatePublished - May 5 1995
Externally publishedYes

Fingerprint

Dive into the research topics of 'The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA'. Together they form a unique fingerprint.

Cite this