Skip to main navigation Skip to search Skip to main content

First report of potato virus V and Peru tomato mosaic virus on Tamarillo (Solanum betaceum) orchards of Ecuador

  • M. L. Insuasti
  • , J. B. Ochoa
  • , R. R. Martin
  • , R. A. Alvarez
  • , D. F. Quito-Avila

Research output: Contribution to journalArticlepeer-review

Abstract

In Ecuador, tamarillo (Solanum betaceum) represents an important crop for hundreds of small farmers in subtropical valleys, where disorders caused by potyviruses have been reported in the past. In 2013, leaves from tamarillo plants showing severe virus-like symptoms (mosaic, mottling, and leaf deformation) were collected from orchards in Pichincha and Tungurahua and pooled into 20-g batches. Double-stranded RNA (dsRNA) was extracted from three independent batches and used to generate cDNA libraries to screen for RNA viruses by shotgun cloning as described by Tzanetakis et al. (2005). Sequencing of 400 transformed plasmids revealed the presence of the potyviruses Potato virus Y (PVY), Potato virus V (PVV), and Peru tomato mosaic virus (PTV), and the polerovirus Potato leaf roll virus (PLRV). Partial sequences obtained in this study [GenBank Accession Nos. KT803899 (PVY), KT803901 (PTV), KT803903 (PVV), KT778300 (PLRV)] were aligned to their counterparts available at GenBank and used to design detection primers for each virus. Based on specificity tested on cDNA obtained from dsRNA or total RNA, the following primers were selected for detection of each virus: PVY_F (GCACTCATGGTGTTGCAGGT)/ PVY_R (GCACATCATACTCTTCCATTTGAGC); PVV_F (CGCAAGAGCCACTCAGAGCCA)/ PVV_R (GCCACATCCTCTGTGGTGTGT); PTV_F: GGTGCCATGTATGGTGGCAAG)/ PTV_R (CTTAGTCATCCCAACGGTCCAAC); PLRV_F (CCTTCCACAGTATCCGGCACTGA)/ PLRV_R (GACGAGGCTCAAGCGAGACAT), with amplification products of 679 nt, 519 nt, 294 nt and 360 nt, respectively. Five independent PCR products for each primer set were cloned and sequenced for confirmation. BLAST alignments of detection PCR products showed nucleotide identities of 89%, 88%, 91%, and 98% for PVY, PVV, PTV, and PLRV, respectively, with their closest counterparts at GenBank. To determine the occurrence of the viruses, 200 leaf samples from symptomatic and asymptomatic tamarillo plants were collected from commercial orchards in Pichincha and Tungurahua and tested by RT-PCR. Total RNA extraction and reverse transcription was done as described by Halgren et al. (2007). For symptomatic plants, PVY and PLRV were the most common with 64% and 30%, respectively. PVV and PTV were found in 8% and 10%, respectively, with only 4% of the plants coinfected by both viruses. Plants coinfected by PVY and PLRV were the most common with 22%, followed by plants coinfected by PVY and PTV (10%). Asymptomatic plants did not test positive for any of the viruses. Symptoms were not consistent across plants infected by the same virus(es). To rule out the presence of additional tamarillo viruses reported in New Zealand (Eagles et al. 1994) and Colombia (Jaramillo et al. 2011), samples were also tested for Cucumber mosaic virus by ELISA (AGDIA) and Tamarillo mosaic virus by RT-PCR using primers designed from alignment of available sequences. Interestingly, all plants tested negative for both viruses. PVY has long been considered the most common virus in tamarillo in Ecuador. This communication reports for the first time in tamarillo the presence of PVV and PTV, two potyviruses once considered strains of PVY (Spetz et al. 2003). Further studies are needed to determine the significance of PVV and PTV in single and mixed infections in tamarillo.

Original languageEnglish (US)
Pages (from-to)868
Number of pages1
JournalPlant disease
Volume100
Issue number4
DOIs
StatePublished - Apr 2016
Externally publishedYes

Bibliographical note

Publisher Copyright:
© 2016, American Phytopathological Society. All rights reserved.

UN SDGs

This output contributes to the following UN Sustainable Development Goals (SDGs)

  1. SDG 2 - Zero Hunger
    SDG 2 Zero Hunger

Fingerprint

Dive into the research topics of 'First report of potato virus V and Peru tomato mosaic virus on Tamarillo (Solanum betaceum) orchards of Ecuador'. Together they form a unique fingerprint.

Cite this