First report of Alfalfa mosaic virus occurrence in Hydrangea in the United States

B. Lockhart, D. Mollov, M. Daughtrey

Research output: Contribution to journalArticlepeer-review

1 Scopus citations

Abstract

In spring of 2012, a previously unrecorded virus-like disease characterized by conspicuous yellow leaf blotching (calico symptoms) was observed in plants of Hydrangea macrophylla in a single location in Southampton, NY. Bacilliform and spherical particles resembling those of Alfalfa mosaic virus (AMV) were observed by transmission electron microscopy (TEM) in partially purified extracts from symptomatic leaf tissue. The identity of the virus was confirmed by immunosorbent electron microscopy (ISEM) (4) using antiserum to AMV (ATCC PVAS 92) that both trapped and decorated the virions. Three primer pairs designed from available AMV RNA 1, RNA 2, and RNA 3 genomic sequences were used to generate amplicons from the hydrangea AMV isolate. Reverse-transcription (RT)-PCR was done using total RNA extracted from symptomatic hydrangea leaf tissue with a Qiagen RNeasy kit, and Ready-to- Go RT-PCR beads (GE Healthcare). Amplicons of 1,049, 1,013, and 658 bp were obtained using the primer pairs AMV1F (5'-ATCCACCGATGCCAGCCTTA)/ AMV1R (5'-TTCCGCCTCACTGCTGTCTG), AMV2F (5'- GATCGCCGGAAGTGATCCAG)/AMV2R (5'-TCACCGGAAGCAACAACGAA), and AMV3F (5'-GCCGGTTCTCCAAAGGGTCT)/AMV3R (5'- CGCGTCGAAGTCCAGACAGA), respectively. The PCR products were cloned using a TOPO TA cloning kit (Invitrogen) and three clones of each were sequenced. The sequences obtained from the hydrangea AMV RNA 1 (JX154090), RNA 2 (JX154091), and RNA 3 (JX154092) had 95 to 98% nucleotide sequence identity to homologous genomic sequences of known AMV isolates. To our knowledge, this is the first report of AMV occurrence in H. macrophylla in the United States. This virus has been reported to occur in H. macrophylla in British Columbia (3), but in a previous survey its presence was not detected in hydrangeas in the United States (1). A report of possible AMV infection in H. macrophylla in Italy (2) was based solely on symptomatology and cross-protection tests and therefore cannot be verified. The AMV-infected hydrangea plants were found by ISEM to also contain low concentrations of Hydrangea ringspot virus (HRSV) and Hydrangea chlorotic mottle virus (HdCMV). However, based on previous evidence of single and mixed infections (3), it is unlikely that the calico symptoms observed were influenced by the presence of HRSV and HdCMV. This report is of interest both because AMV, unlike HRSV and HdCMV, causes foliar symptoms that would render hydrangea plant unmarketable, and because the disease can be spread by a number of common aphid species that transmit AMV. It will also serve to alert growers and diagnosticians to the potential threat posed by AMV infection.

Original languageEnglish (US)
Number of pages1
JournalPlant disease
Volume97
Issue number9
DOIs
StatePublished - Aug 20 2013

Fingerprint Dive into the research topics of 'First report of Alfalfa mosaic virus occurrence in Hydrangea in the United States'. Together they form a unique fingerprint.

Cite this