Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

Amelia R.I. Lindsey, Danny W. Rice, Sarah R. Bordenstein, Andrew W. Brooks, Seth R. Bordenstein, Irene L.G. Newton

Research output: Contribution to journalComment/debatepeer-review

Abstract

Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.

Original languageEnglish (US)
Pages (from-to)1320
Number of pages1
JournalGenome biology and evolution
Volume11
Issue number4
DOIs
StatePublished - Apr 1 2019

Bibliographical note

Publisher Copyright:
© 2019 The Author(s). Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Fingerprint

Dive into the research topics of 'Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)'. Together they form a unique fingerprint.

Cite this